Promega Corporation

pTargeT™ Sequencing Primer

The pTargeT™ Sequencing Primer is designed for sequencing inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410). The sequencing primer hybridizes to the region of the lacZ gene at nucleotides 1367–1344 on the pTargeT™ Vector.

The primer can be used only for sequencing inserts cloned into the pTargeT™ Vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts.

The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.

The primer is supplied at a concentra...

Expand to Read More »

  • Share
  • Print
  • Email
  • Prices valid for customers of Promega AG only
Product Size Conc. Catalog # *List Price Order QTY Add to Cart

pTargeT™ Sequencing Primer

Close Window

pTargeT™ Sequencing Primer


  • pTargeT™ Sequencing Primer (24mer)

    Q446A1 x 2μg
Close Window
  • This product can be added to a

  • Helix Freezer

This product is available through the Promega Helix onsite stocking program in a –20°C Helix Freezer. The program offers numerous convenient solutions to meet your lab's needs. Helix Freezers are available in two sizes: 5.7 cubic ft. or 9.7 cubic ft.

Click here to learn more about the Helix Collection »

Already a Helix Customer?

Request to add this product to your Helix »

- Q4461 CHF 135.00 Add to cart

You Also May Be Interested In

Storage Conditions

Store at –20°C.

For product intended use please see Patents & Disclaimers tab.

Use Restrictions

Q4461 For Research Use Only. Not for Use in Diagnostic Procedures.

Prefer a different language?

Your country is set to Switzerland. Your language is set to English. Please select the language that will best suit your needs:

This is correct, continue to site »

I need additional help

It appears that you have Javascript disabled. Our website requires Javascript to function correctly. For the best browsing experience, please enable Javascript.